SubtiBank SubtiBank
araQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

araQ

[SW|ABC transporter] for the uptake of α-1,5-arabinooligosaccharides, at least up to four L-arabinosyl units (integral membrane protein)
locus
BSU28730
pI
9.33
mw
31.63 kDa
protein length
281 aa Sequence Blast
gene length
843 bp Sequence Blast
function
uptake of α-1,5-arabinooligosaccharides
product
α-1,5-arabinooligosaccharide [SW|ABC transporter] (integral membrane protein)
essential
no
synonyms
yseE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.6|Utilization of arabinan/ arabinose/ arabitol]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,939,851 → 2,940,696

    The protein

    Protein family

  • MalFG subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 25% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|028428CE456E283C065756878EA7C7DB495DD10D|araA]-[gene|E0525A4187D9C8A23F23BC8F883973896C8D295D|araB]-[gene|3859854178E573AE8ACCE6DF85E32C495D316DA1|araD]-[gene|BBAD1638F435791C1846EFFAD6B6F82CE491FDF1|araL]-[gene|16EE17461B4AB467A4F8172FD3E335073AD2B1D8|araM]-[gene|C1F5D0EA21DCA5F8EC43720CDF67E859CA7B866E|araN]-[gene|8AF43CA410F3381209196E1B9A4FE66D78020793|araP]-[gene|AE532A8931D516CC676E765D1D1293E73C335D23|araQ]-[gene|2B2629D275491A9F7031D5A99BAA001B011A765B|abfA]
    description
    [Pubmed|9084180]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084180], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12949161], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|A567466894AE9DE7CDE7816615433A37532297B5|AraR]: repression, [Pubmed|10417639], in [regulon|A567466894AE9DE7CDE7816615433A37532297B5|AraR regulon]
  • regulation

  • induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A987 (araQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/987 NBRP B. subtilis, Japan]
  • BKE28730 (Δ[gene|AE532A8931D516CC676E765D1D1293E73C335D23|araQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTGAGGACTGTGCCGCA, downstream forward: _UP4_GGTTAATGAAGGAGGAAACG
  • BKK28730 (Δ[gene|AE532A8931D516CC676E765D1D1293E73C335D23|araQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAACTGAGGACTGTGCCGCA, downstream forward: _UP4_GGTTAATGAAGGAGGAAACG
  • References

  • 12884008,10092453,10417639,9084180,12949161,29240795,20693325,26235029