SubtiBank SubtiBank
liaH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

liaH

accessory subunit of the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] [SW|protein secretion] complex, similar to phage shock protein, resistance against oxidative stress and cell wall antibiotics (such as daptamycin), secondary bacitracin resistance determinant
locus
BSU_33120
pI
6.17
mw
25.55 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
resistance against oxidative stress and cell wall antibiotics, [SW|protein secretion]
product
accessory subunit of the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] [SW|protein secretion] complex
essential
no
synonyms
yvqH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,397,846 3,398,523

    The protein

    Protein family

  • pspA/IM30 family (with [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|PspA], according to UniProt)
  • Paralogous protein(s)

  • [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|PspA]
  • [SW|Localization]

  • variable (spotty) protein [Pubmed|16479537]
  • throughout the cytoplasm under non-inducing conditions [Pubmed|24666271]
  • co-localizes with [protein|B6D1159454969D1D578E05D5CE2259E079688510|LiaI] in distinct static spots at the cytoplasma membrane under stress conditions [Pubmed|24666271]
  • Expression and Regulation

    Operons

    genes
    [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]
    description
    [Pubmed|20639339]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • induced by bacitracin and rhamnolipids, induction requires high bacitracin concentrations ([protein|search|LiaR]) [Pubmed|16816187,22092710,26815905]
  • view in new tab

    genes
    [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
    description
    [Pubmed|14651641]

    regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B039 (yvqH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1038 NBRP B. subtilis, Japan]
  • BKE33120 ([gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTGATTCCTCCTAAT, downstream forward: _UP4_TAAGCGGAACGGGGAAGGAT
  • BKK33120 ([gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTGATTCCTCCTAAT, downstream forward: _UP4_TAAGCGGAACGGGGAAGGAT
  • References

    Reviews

  • 27344142
  • Original publications

  • 19164152,15273097,20057163,16816187,15101989,17660417,16816187,20639339,16479537,20817675,22092710,24666271,27791134,26815905,32302670