SubtiBank SubtiBank
liaH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

liaH

similar to phage shock protein, resistance against oxidative stress and cell wall antibiotics (such as daptamycin), secondary bacitracin resistance determinant
locus
BSU_33120
pI
6.17
mw
25.55 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
resistance against oxidative stress and cell wall antibiotics
product
unknown
essential
no
synonyms
yvqH

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,397,846 3,398,523

    The protein

    Protein family

  • pspA/IM30 family (with [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|PspA], according to UniProt)
  • Paralogous protein(s)

  • [protein|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|PspA]
  • [SW|Localization]

  • variable (spotty) protein [Pubmed|16479537]
  • throughout the cytoplasm under non-inducing conditions [Pubmed|24666271]
  • co-localizes with [protein|B6D1159454969D1D578E05D5CE2259E079688510|LiaI] in distinct static spots at the cytoplasma membrane under stress conditions [Pubmed|24666271]
  • Expression and Regulation

    Operons

    genes
    [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]
    description
    [Pubmed|20639339]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • induced by bacitracin and rhamnolipids, induction requires high bacitracin concentrations ([protein|search|LiaR]) [Pubmed|16816187,22092710,26815905]
  • view in new tab

    genes
    [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
    description
    [Pubmed|14651641]

    regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B039 (yvqH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1038 NBRP B. subtilis, Japan]
  • BKE33120 ([gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTGATTCCTCCTAAT, downstream forward: _UP4_TAAGCGGAACGGGGAAGGAT
  • BKK33120 ([gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTGATTCCTCCTAAT, downstream forward: _UP4_TAAGCGGAACGGGGAAGGAT
  • References

    Reviews

  • 27344142
  • Original publications

  • 19164152,15273097,20057163,16816187,15101989,17660417,16816187,20639339,16479537,20817675,22092710,24666271,27791134,26815905