SubtiBank SubtiBank
sacP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sacP

sucrose permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT] activity
locus
BSU_38050
pI
7.03
mw
49.29 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
function
sucrose uptake and phosphorylation, control of [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT] activity
product
sucrose-specific [category|SW 1.2.2|PTS] permease, EIIBC component
essential
no
ec
2.7.1.69
synonyms
ipa-49d

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    Coordinates
    3,903,646 3,905,031

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|TreP], [protein|531F132F7F6A878F1E1D56977B9898A14272349A|SacX], [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|MurP]
  • [SW|Domains]

  • [SW|PTS EIIB domain] type-1 (aa 1-87) (according to UniProt)
  • [SW|PTS EIIC domain] type-1 (aa 107-461) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]
    description
    [Pubmed|3100393]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8702561], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT]: antitermination, via binding to a [SW|RNA switch], in [regulon|6796E1C147AA21E919A42A953884DC24E182F430|SacT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
  • view in new tab

    Biological materials

    Mutant

  • BKE38050 ([gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCCCCCTTTT, downstream forward: _UP4_AATGAGGATGAGGAGAGGAA
  • BKK38050 ([gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTCTCCCCCTTTT, downstream forward: _UP4_AATGAGGATGAGGAGAGGAA
  • Expression vectors

  • for expression, purification of the EIIB domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP429, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of the EIIB domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP436, available in [SW|Jörg Stülke]'s lab
  • References

  • 10627040,12107147,3122206,2163394,8702561,2120236,22900538,30038046