SubtiBank SubtiBank
yczJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yczJ

unknown
locus
BSU_04130
pI
4.96
mw
11.08 kDa
protein length
gene length
288 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    463,496 463,783

    The protein

    [SW|Domains]

  • [SW|ABM domain] (aa 2-92) (according to UniProt)
  • Structure

  • [PDB|3GZ7] (from Bordetella bronchiseptica, 33% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE04130 ([gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCCTTCTTTCTG, downstream forward: _UP4_CATTTTCAGGATGTGTAATA
  • BKK04130 ([gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCCTTCTTTCTG, downstream forward: _UP4_CATTTTCAGGATGTGTAATA