SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


11.08 kDa
protein length
gene length
288 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    463,496 463,783

    The protein


  • [SW|ABM domain] (aa 2-92) (according to UniProt)
  • Structure

  • [PDB|3GZ7] (from Bordetella bronchiseptica, 33% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE04130 ([gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCCTTCTTTCTG, downstream forward: _UP4_CATTTTCAGGATGTGTAATA
  • BKK04130 ([gene|ADE7B8EC308F74E642E98AF911048AD03F869A3F|yczJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCCTTCTTTCTG, downstream forward: _UP4_CATTTTCAGGATGTGTAATA