SubtiBank SubtiBank
rsbT [2019-07-23 09:47:07]

rsbT [2019-07-23 09:47:07]

PP2C activator, protein serine kinase, phosphorylates [protein|841CE7FCA4E84445830CA18F9856F6F30014E3BB|RsbS] and [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], part of the [SW|stressosome]
locus
BSU_04690
pI
6.59
mw
14.21 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
product
PP2C activator, protein serine kinase
essential
no
synonyms
ycxT

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • Gene

    Coordinates
    520,606 521,007

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB], [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|RsbRC], and [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD] [Pubmed|21362065]
  • Effectors of protein activity

  • phosphorylated [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] activates the kinase activity of [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|23320651]
  • activity is stimulated by light in a [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]-dependent manner [Pubmed|23416074]
  • Structure

  • [PDB|3VY9] (complete stressosome)
  • Expression and Regulation

    Operons

    genes
    [gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|8002610]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE04690 ([gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACACAGGATTGGTCGTTCA, downstream forward: _UP4_TGGCTTCGGTAGGAGGTAAG
  • BKK04690 ([gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACACAGGATTGGTCGTTCA, downstream forward: _UP4_TGGCTTCGGTAGGAGGTAAG
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • [SW|Rick Lewis], Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/r.lewis homepage]
  • References

    Reviews

  • 19704888,16319496,20658979,28271471
  • Original publications

  • 8682789,8002610,8682769,9658013,17303566,9786195,15090521,10781545,15583165,8824586,10329124,16321960,8808936,15312768,11244072,15342582,20019076,12499568,12950928,16321960,8955331,18832644,24599254,23407164,23320651,21362065,23416074,21979936,27977677,28727759