SubtiBank SubtiBank
rsbT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rsbT

PP2C activator, protein serine kinase, phosphorylates [protein|841CE7FCA4E84445830CA18F9856F6F30014E3BB|RsbS] and [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], part of the [SW|stressosome]
locus
BSU_04690
pI
6.59
mw
14.21 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
product
PP2C activator, protein serine kinase
essential
no
synonyms
ycxT

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • Gene

    Coordinates
    520,606 521,007

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB], [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|RsbRC], and [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD] [Pubmed|21362065]
  • ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
  • ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
  • Effectors of protein activity

  • phosphorylated [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] activates the kinase activity of [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|23320651]
  • activity is stimulated by light in a [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]-dependent manner [Pubmed|23416074]
  • Structure

  • [PDB|3VY9] (complete stressosome)
  • Expression and Regulation

    Operons

    genes
    [gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|8002610]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE04690 ([gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACACAGGATTGGTCGTTCA, downstream forward: _UP4_TGGCTTCGGTAGGAGGTAAG
  • BKK04690 ([gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACACAGGATTGGTCGTTCA, downstream forward: _UP4_TGGCTTCGGTAGGAGGTAAG
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • [SW|Rick Lewis], Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/r.lewis homepage]
  • References

    Reviews

  • 19704888,16319496,20658979,28271471,33042030
  • Original publications

  • 8682789,8002610,8682769,9658013,17303566,9786195,15090521,10781545,15583165,8824586,10329124,16321960,8808936,15312768,11244072,15342582,20019076,12499568,12950928,16321960,8955331,18832644,24599254,23407164,23320651,21362065,23416074,21979936,27977677,28727759