SubtiBank SubtiBank
bmr
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bmr

general stress protein, multidrug-efflux transporter
locus
BSU_24010
pI
9.70
mw
42.10 kDa
protein length
389 aa Sequence Blast
gene length
1170 bp Sequence Blast
function
multidrug resistance
product
multidrug-efflux transporter
essential
no
synonyms
bmr1

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,494,656 2,495,825

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|TCR/Tet family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B7C4BE1A252C6376B28C4FCC6EA9DCF3BC096405|Blt]
  • Expression and Regulation

    Operons

    genes
    [gene|ADBC0F194B601F736492E54011E0A68351B5BD39|bmr]-[gene|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|bmrR]
    description
    [Pubmed|7961792]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10200972], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|BmrR]: activation, [Pubmed|7961792], in [regulon|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|BmrR regulon]
  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|10200972], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • regulation

  • ''[protein|search|bmrU]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]-[gene|ADBC0F194B601F736492E54011E0A68351B5BD39|bmr]-[gene|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|bmrR]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|bmrU]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE24010 ([gene|ADBC0F194B601F736492E54011E0A68351B5BD39|bmr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACTTCCCCTTTTTC, downstream forward: _UP4_TGATAAGAAGCGCATTCTTT
  • BKK24010 ([gene|ADBC0F194B601F736492E54011E0A68351B5BD39|bmr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACTTCCCCTTTTTC, downstream forward: _UP4_TGATAAGAAGCGCATTCTTT
  • References

  • 7608059,10220166,11544224,10200972,7961792,20230832,25756668