SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


probable glucose/mannose:H+ symporter
44.75 kDa
protein length
401 aa Sequence Blast
gene length
1206 bp Sequence Blast
probable glucose/mannose:H+ symporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Carbohydrate transporter]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,125,123 1,126,328

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14612444], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|NtdR]: activation, in [regulon|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|NtdR regulon]
  • regulation

  • induced by 3,3'-neotrehalosadiamine ([protein|search|NtdR]) [Pubmed|14612444]
  • view in new tab

    Biological materials


  • MGNA-A723 (yhjI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10520 ([gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTACACCCCTATAT, downstream forward: _UP4_TAGAAAACGTATAAAATAAA
  • BKK10520 ([gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTACACCCCTATAT, downstream forward: _UP4_TAGAAAACGTATAAAATAAA
  • References


  • 21512256
  • Original publications

  • 19087206,17056753,14612444,9457850