SubtiBank SubtiBank
ywcA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywcA

similar to Na+-dependent acetate symporter
locus
BSU_38240
pI
7.20
mw
54.79 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-31r

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.1|Solute:sodium symporter family]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,924,225 3,925,766

    Phenotypes of a mutant

  • ''[gene|4583EA9A4DF9F9EC054437CFB1C3849EA7BD49FA|ywcB]-[gene|ADB447B0F8EA4F341FA48344AA958E6B98B9EFE4|ywcA]'' mutant has slightly reduced acetic acid transport [Pubmed|26060272]
  • ''[gene|4583EA9A4DF9F9EC054437CFB1C3849EA7BD49FA|ywcB]-[gene|ADB447B0F8EA4F341FA48344AA958E6B98B9EFE4|ywcA]'' mutant shows earlier pellicle biofilm formation [Pubmed|26060272]
  • The protein

    Catalyzed reaction/ biological activity

  • the protein is involved in acetate transport [Pubmed|26060272]
  • the protein is not involved in proline transport [Pubmed|24142252]
  • Protein family

  • [SW|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4583EA9A4DF9F9EC054437CFB1C3849EA7BD49FA|ywcB]-[gene|ADB447B0F8EA4F341FA48344AA958E6B98B9EFE4|ywcA]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B229 (ywcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1228 NBRP B. subtilis, Japan]
  • available in [SW|Erhard Bremer]'s lab [Pubmed|24142252]
  • BKE38240 ([gene|ADB447B0F8EA4F341FA48344AA958E6B98B9EFE4|ywcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATAATAAAAAAGCAGTCA, downstream forward: _UP4_TAAAAAAAGCTCTCTTTATC
  • BKK38240 ([gene|ADB447B0F8EA4F341FA48344AA958E6B98B9EFE4|ywcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATAATAAAAAAGCAGTCA, downstream forward: _UP4_TAAAAAAAGCTCTCTTTATC
  • References

  • 26060272,15699190,24142252,14563880