SubtiBank SubtiBank


repressor of the glycolytic [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] operon, [SW|DeoR family]
37.23 kDa
protein length
340 aa Sequence Blast
gene length
1023 bp Sequence Blast
transcriptional regulator
central glycolytic genes regulator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    3,482,752 3,483,774

    Phenotypes of a mutant

  • suppresses the growth defect of [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutants on gluconeogenic substrates [Pubmed|16272399]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription repression of the glycolytic ''[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' operon
  • Protein family

  • SorC transcriptional regulatory family (with [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR], according to UniProt)
  • [SW|Domains]

  • DNA binding domain (H-T-H motif) (3756)
  • Effectors of protein activity

  • fructose 1.6-bisphosphate [Pubmed|29923648,12622823] and dihydroxyacetone phosphate, glucose-6-phosphate and fructose-6-phosphate [Pubmed|18554327] act as inducer and result in release of [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] from the DNA
  • Structure

  • [PDB|3BXH] (in complex with fructose-6-phosphate) [pubmed|18554327]
  • [PDB|2OKG] (effector binding domain) [pubmed|18554327]
  • [SW|Localization]

  • cytoplasma [Pubmed|20572937]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [Pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] [Pubmed|11489127]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glucose (10 fold) ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [Pubmed|12850135,12622823]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-A463 (yvbQ::erm), available at the [ NBRP B. subtilis, Japan]
  • GP311 (in frame deletion), available in [SW|Jörg Stülke]'s lab
  • SM-NB7 (cggR-spc), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs
  • BKE33950 ([gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAACGTTCCTTC, downstream forward: _UP4_TAATCCCTCAATATAAATAT
  • BKK33950 ([gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAACGTTCCTTC, downstream forward: _UP4_TAATCCCTCAATATAAATAT
  • Expression vectors

  • pGP705 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP504 (in [SW|pAC7]), pGP509 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References


  • 20408793
  • Original Publications

  • 20462860,22190493,23280112,21815947,19193632,12850135,12622823,18186488,10799476,11489127,12123463,12634343,18052209,17293407,20361740,20444087,18554327,25099370,26883633,16272399,29923648,30082753