SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional activator of the malA-glvR-malP operon
29.15 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
regulation of maltose utilization
transcriptional activator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of maltose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    891,436 892,200

    The protein


  • HTH rpiR-type domain (aa 1-77) (according to UniProt)
  • [SW|SIS domain] (aa 106-248) (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489864], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR]: activation, [Pubmed|11489864], in [regulon|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|11489864], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induction by maltose ([protein|search|GlvR]) [Pubmed|11489864]
  • view in new tab

    Biological materials


  • MGNA-C290 (yfiA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08190 ([gene|AD72489DA260F07B97A213F1F0FBA7CED9471817|glvR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAGATCCCCCCATTT, downstream forward: _UP4_AATGACAATGAGTAGCAGGGG
  • BKK08190 ([gene|AD72489DA260F07B97A213F1F0FBA7CED9471817|glvR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAGATCCCCCCATTT, downstream forward: _UP4_AATGACAATGAGTAGCAGGGG
  • References

  • 11489864