SubtiBank SubtiBank
mfd [2018-03-17 17:02:14]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mfd [2018-03-17 17:02:14]

transcription-repair coupling factor, eliminates genetic damage from transcriptionally active genes during sporulation, required for increased mutagenesis of lagging strand genes
locus
BSU00550
pI
5.37
mw
133.59 kDa
protein length
1177 aa Sequence Blast
gene length
3531 bp Sequence Blast
function
promotes strand-specific DNA repair by displacing
product
transcription-repair coupling factor
essential
no
ec
3.6.4.-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.3|Transcription elongation/ termination]
  • Gene

    Coordinates
    60,430 → 63,963

    Phenotypes of a mutant

  • in an ''mfd'' knock-out, the cell's ability to accumulate adaptive mutations in stationary phase is depressed [http://www.pubmed.com/16950921 PubMed]
  • strongly reduced stationary phase mutagenesis [Pubmed|27399782]
  • increased UV-induced mutagenesis via [protein|C87D33852F263A553CA747608E6200E4AD8344B5|PolY1]/ [protein|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|PolY2]-mediated translesion synthesis [Pubmed|24118570]
  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • promotes strand-specific DNA repair by displacing [SW|RNA polymerase] stalled at a nucleotide lesion and directing the (A)BC excinuclease to the RNA damage site
  • is required for roadblock transcription repression by transcription factors with binding sites downstream of the promoter (as for [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] [Pubmed|9535092] and [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY] [Pubmed|21699902])
  • required for the processing of genetic damage during [SW|sporulation] [Pubmed|24118570]
  • Paralogous protein(s)

  • [protein|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|RecU], [protein|24B1C2A663A5B7C45940272595868F9F05A04A7B|RecG]
  • Structure

  • [PDB|2EYQ] (Mfd from ''E. coli'') [Pubmed|16469698]
  • [PDB|3MLQ] (RNA polymerase interacting domain of ''Thermus thermophilus'' [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd] with the ''Thermus aquaticus'' [protein|EC32328548BFB59D9026ACE351C946DBBC0932BC|RpoB] beta1 domain) [Pubmed|20702425]
  • additional information

  • [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation

    Operons

    genes
    [gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]-[gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]-[gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP1167 (del ermC), available in [SW|Jörg Stülke]'s lab [Pubmed|22178973]
  • BKE00550 (''[gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE00550 (Δ[gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
  • BKK00550 (Δ[gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
  • GFP fusion

  • GP1510 (spc, based on [SW|pGP1870], [SW|pGP1389]-derivative ), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • Antibody

  • **
  • References

    Reviews

  • 17239578,15063847,17917874,8811173,7968917,15720542,16464004,19023283,22201950,22749141,22933559,26132790
  • Original publications

  • 8594198,20435731,104170,16950921,9535092,16469698,21699902,22178973,22248542,22960746,21710567,20702425,24296669,21145481,24118570,25326311,25961799,25713353,27399782,28700593,29536659