SubtiBank SubtiBank
mfd
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mfd

[SW|transcription]-repair coupling factor, eliminates genetic damage from transcriptionally active genes during sporulation, required for increased mutagenesis of lagging strand genes
locus
BSU_00550
pI
5.37
mw
133.59 kDa
protein length
1177 aa Sequence Blast
gene length
3534 bp Sequence Blast
function
promotes strand-specific DNA repair by displacing
product
[SW|transcription]-repair coupling factor
essential
no
ec
3.6.4.-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.3|Transcription elongation/ termination]
  • Gene

    Coordinates
    60,430 63,963

    Phenotypes of a mutant

  • in an ''mfd'' knock-out, the cell's ability to accumulate adaptive mutations in stationary phase is depressed [http://www.pubmed.com/16950921 PubMed]
  • strongly reduced stationary phase mutagenesis [Pubmed|27399782]
  • increased UV-induced mutagenesis via [protein|C87D33852F263A553CA747608E6200E4AD8344B5|PolY1]/ [protein|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|PolY2]-mediated translesion synthesis [Pubmed|24118570]
  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants [Pubmed|24296669]
  • sensitive to blue light-induced DNA damage [pubmed|30054368]
  • sensitive to oxidative stress [pubmed|30691388]
  • The protein

    Catalyzed reaction/ biological activity

  • promotes strand-specific DNA repair by displacing [SW|RNA polymerase] stalled at a nucleotide lesion and directing the (A)BC excinuclease to RNA damage site
  • is required for roadblock transcription repression by transcription factors with binding sites downstream of the promoter (as for [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] [Pubmed|9535092] and [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY] [Pubmed|21699902])
  • required for the processing of genetic damage during [SW|sporulation] [Pubmed|24118570]
  • Protein family

  • N-terminal part: UvrB family (with [protein|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|UvrB], according to UniProt)
  • C-terminal part: [SW|helicase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|RecU], [protein|24B1C2A663A5B7C45940272595868F9F05A04A7B|RecG]
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 638-799) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 820-974) (according to UniProt)
  • Structure

  • [PDB|2EYQ] (Mfd from ''E. coli'') [Pubmed|16469698]
  • [PDB|3MLQ] (RNA polymerase interacting domain of ''Thermus thermophilus'' [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd] with the ''Thermus aquaticus'' [protein|EC32328548BFB59D9026ACE351C946DBBC0932BC|RpoB] beta1 domain) [Pubmed|20702425]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • additional information

  • [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation

    Operons

    genes
    [gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]-[gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]-[gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP1167 (del ermC), available in [SW|Jörg Stülke]'s lab [Pubmed|22178973]
  • BKE00550 (''[gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE00550 ([gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
  • BKK00550 ([gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
  • GFP fusion

  • GP1510 (spc, based on [SW|pGP1870], [SW|pGP1389]-derivative ), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • Antibody

  • **
  • References

    Reviews

  • 17239578,15063847,17917874,8811173,7968917,15720542,16464004,19023283,22201950,22749141,22933559,26132790,29856930
  • Original publications

  • 8594198,20435731,104170,16950921,9535092,16469698,21699902,22178973,22248542,22960746,21710567,20702425,24296669,21145481,24118570,25326311,25961799,25713353,27399782,28700593,29536659,30054368,30691388