SubtiBank SubtiBank
yktC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yktC

inositol monophosphatase and 5'-nucleotidase with preference for GMP and IMP
locus
BSU_14670
pI
5.09
mw
29.61 kDa
protein length
265 aa Sequence Blast
gene length
798 bp Sequence Blast
function
unknown
product
nucleotidase
essential
no
ec
3.1.3.25
synonyms
suhB

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,537,441 1,538,238

    Phenotypes of a mutant

  • sensitive to diamide stress [Pubmed|27784292]
  • The protein

    Catalyzed reaction/ biological activity

  • myo-inositol phosphate + H2O --> myo-inositol + phosphate (according to UniProt)
  • Protein family

  • inositol monophosphatase superfamily (single member, according to UniProt)
  • Structure

  • [PDB|5I3S] (from Staphylococcus aureus, 51% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|AD151804FC145854DB6BAA12CD52758FB1C3882F|yktC]-[gene|A313B197D6D885EEE7F739E1F137794A8E3AD8F9|ykzC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A908 (yktC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/908 NBRP B. subtilis, Japan]
  • BKE14670 ([gene|AD151804FC145854DB6BAA12CD52758FB1C3882F|yktC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTCGTACCTCTCTT, downstream forward: _UP4_TAGGCCATTTGAGCAGGATG
  • BKK14670 ([gene|AD151804FC145854DB6BAA12CD52758FB1C3882F|yktC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTCGTACCTCTCTT, downstream forward: _UP4_TAGGCCATTTGAGCAGGATG
  • References

  • 19935659,26577401,27784292