SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to GCN5-related N-acetyltransferase
16.86 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    4,184,017 4,184,463

    The protein

    Paralogous protein(s)

  • [protein|DBEB1E43E1121D3D8AB6A0CA3BAF4072715F6577|YybD], [protein|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|YjcF]
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-144) (according to UniProt)
  • Structure

  • [PDB|1Q2Y] ([protein|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|YjcF], 43% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B854 (yyaT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40720 ([gene|AD0F95A25190DA7E253F4C93BC160B1EA91AAE04|yyaT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGAATCAATCCTTTT, downstream forward: _UP4_AAAGAAATATCGCGGAATAT
  • BKK40720 ([gene|AD0F95A25190DA7E253F4C93BC160B1EA91AAE04|yyaT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGAATCAATCCTTTT, downstream forward: _UP4_AAAGAAATATCGCGGAATAT