SubtiBank SubtiBank
yyaT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyaT

similar to GCN5-related N-acetyltransferase
locus
BSU_40720
pI
6.42
mw
16.86 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,184,017 4,184,463

    The protein

    Paralogous protein(s)

  • [protein|DBEB1E43E1121D3D8AB6A0CA3BAF4072715F6577|YybD], [protein|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|YjcF]
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-144) (according to UniProt)
  • Structure

  • [PDB|1Q2Y] ([protein|5E4C3ADF5B5D0215E9E350F16BCA57B208933606|YjcF], 43% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|AD0F95A25190DA7E253F4C93BC160B1EA91AAE04|yyaT]-[gene|199FA65621C241CB27BBC382A4C62A34DCC74570|yyaS]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B854 (yyaT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1853 NBRP B. subtilis, Japan]
  • BKE40720 ([gene|AD0F95A25190DA7E253F4C93BC160B1EA91AAE04|yyaT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGAATCAATCCTTTT, downstream forward: _UP4_AAAGAAATATCGCGGAATAT
  • BKK40720 ([gene|AD0F95A25190DA7E253F4C93BC160B1EA91AAE04|yyaT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGAATCAATCCTTTT, downstream forward: _UP4_AAAGAAATATCGCGGAATAT