SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


signal peptide peptidase required for efficient processing of pre-proteins, cleaves remnant signal peptides within the cellular membrane
36.52 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
protein secretion
signal peptide peptidase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,020,040 3,021,047

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Catalyzed reaction/ biological activity

  • serine protease that functions to cleave the remnant signal peptides left behind after [SW|protein secretion] and cleavage by signal peptidases
  • Protein family

  • peptidase S49 family (single member, according to UniProt)
  • Structure

  • [PDB|3RST] [Pubmed|22472423]
  • [SW|Localization]

  • cell membrane [Pubmed|22472423]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced in response to cell wall stress ([protein|search|SigW]) [Pubmed|12207695]
  • additional information

  • self-processes its own C-termini [PubMed|24228759]
  • view in new tab

    Biological materials


  • MGNA-A005 (yteI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
  • BKK29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
  • References

  • 9987136,12207695,22472423,23980836,24228759,24228759,31424929