sppA

protease, promotes resistance to antimicrobial peptides

locus: BSU_29530

pI: 7.31

mw: 36.52 kDa

protein length: 335 aa

gene length: 1008 bp

function: resistance to lantibiotics

product: protease

essential: no

synonyms: yteI

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,020,040 3,021,047

Phenotypes of a mutant

• more sensitive to lantibiotics such as nisin and subtilin [Pubmed|33028682,23980836]
• reduced long-term survival [pubmed|33028682]

The protein

Catalyzed reaction/ biological activity

• serine protease that functions to cleave the remnant signal peptides left behind after [SW|protein secretion] and cleavage by signal peptidases

Protein family

• peptidase S49 family (single member, according to UniProt)

Structure

• [PDB|3RST] [Pubmed|22472423]

[SW|Localization]

• cell membrane [Pubmed|33028682,22472423]

Expression and Regulation

Operons

• genes: [gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]-[gene|618337D9BCD1586C5874746D1001DA3A2724E57C|sppI]
  description: [Pubmed|9987136]

  sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]

  regulation

  • induced in response to cell wall stress ([protein|search|SigW]) [Pubmed|12207695]

  additional information

  • self-processes its own C-termini [PubMed|24228759]

Biological materials

Mutant

• MGNA-A005 (yteI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/5 NBRP B. subtilis, Japan]
• BKE29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
• BKK29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC

References

• 9987136,12207695,22472423,23980836,24228759,24228759,31424929,33028682