SubtiBank SubtiBank
sppA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sppA

signal peptide peptidase required for efficient processing of pre-proteins, cleaves remnant signal peptides within the cellular membrane
locus
BSU_29530
pI
7.31
mw
36.52 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
function
protein secretion
product
signal peptide peptidase
essential
no
synonyms
yteI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,020,040 3,021,047

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Catalyzed reaction/ biological activity

  • serine protease that functions to cleave the remnant signal peptides left behind after [SW|protein secretion] and cleavage by signal peptidases
  • Protein family

  • peptidase S49 family (single member, according to UniProt)
  • Structure

  • [PDB|3RST] [Pubmed|22472423]
  • [SW|Localization]

  • cell membrane [Pubmed|22472423]
  • Expression and Regulation

    Operons

    genes
    [gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]-[gene|618337D9BCD1586C5874746D1001DA3A2724E57C|yteJ]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced in response to cell wall stress ([protein|search|SigW]) [Pubmed|12207695]
  • additional information

  • self-processes its own C-termini [PubMed|24228759]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A005 (yteI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/5 NBRP B. subtilis, Japan]
  • BKE29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
  • BKK29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
  • References

  • 9987136,12207695,22472423,23980836,24228759,24228759,31424929