SubtiBank SubtiBank
sppA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sppA

protease, promotes resistance to antimicrobial peptides
locus
BSU_29530
pI
7.31
mw
36.52 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
function
resistance to lantibiotics
product
protease
essential
no
synonyms
yteI

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,020,040 3,021,047

    Phenotypes of a mutant

  • more sensitive to lantibiotics such as nisin and subtilin [Pubmed|33028682,23980836]
  • reduced long-term survival [pubmed|33028682]
  • The protein

    Catalyzed reaction/ biological activity

  • serine protease that functions to cleave the remnant signal peptides left behind after [SW|protein secretion] and cleavage by signal peptidases
  • Protein family

  • peptidase S49 family (single member, according to UniProt)
  • Structure

  • [PDB|3RST] [Pubmed|22472423]
  • [SW|Localization]

  • cell membrane [Pubmed|33028682,22472423]
  • Expression and Regulation

    Operons

    genes
    [gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]-[gene|618337D9BCD1586C5874746D1001DA3A2724E57C|sppI]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced in response to cell wall stress ([protein|search|SigW]) [Pubmed|12207695]
  • additional information

  • self-processes its own C-termini [PubMed|24228759]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A005 (yteI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/5 NBRP B. subtilis, Japan]
  • BKE29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
  • BKK29530 ([gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCTCCTCCTTTTT, downstream forward: _UP4_TATGCGAAGTAGGAGGGAAC
  • References

  • 9987136,12207695,22472423,23980836,24228759,24228759,31424929,33028682