SubtiBank SubtiBank
etfA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

etfA

electron transfer flavoprotein (alpha subunit)
locus
BSU28520
pI
4.65
mw
34.39 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
function
fatty acid degradation, calcium carbonate biomineralization
product
electron transfer flavoprotein (alpha subunit)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.3|Utilization of fatty acids]
  • Gene

    Coordinates
    2,915,365 2,916,342

    The protein

    Protein family

  • ETF alpha-subunit/fixB family (according to Swiss-Prot)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1EFV] (the human protein, 39% identity) [pubmed|8962055]
  • Expression and Regulation

    Operons

    genes
    [gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]-[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21398533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    genes
    [gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
    description
    [Pubmed|17189250]

    regulation

  • induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials

    Mutant

  • 1A856 ( ''etfA''::''cat''), [Pubmed|17085570], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A856&Search=1A856 BGSC]
  • BKE28520 ([gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAACATCCCCCTGTT, downstream forward: _UP4_TAAAGGAAATCCCGGACTTT
  • BKK28520 ([gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAACATCCCCCTGTT, downstream forward: _UP4_TAAAGGAAATCCCGGACTTT
  • References

    Reviews

  • 17919287
  • Original Publications

  • 17085570,17189250,20059546,21398533,8962055