SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


mannose-6-phosphate isomerase
35.27 kDa
protein length
316 aa Sequence Blast
gene length
951 bp Sequence Blast
mannose utilization
mannose-6-phosphate isomerase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of mannose]
  • Gene

    3,687,597 3,688,547

    The protein

    Catalyzed reaction/ biological activity

  • D-mannose 6-phosphate --> D-fructose 6-phosphate (according to UniProt)
  • Protein family

  • mannose-6-phosphate isomerase type 1 family (with [protein|E26C70893C5D677C816C814558CC42F90B920087|ManA] and [protein|35225776F6044513D3E77DBBD6A7A8FE976F506A|GmuF], according to UniProt)
  • Paralogous protein(s)

  • [protein|E26C70893C5D677C816C814558CC42F90B920087|ManA], [protein|35225776F6044513D3E77DBBD6A7A8FE976F506A|GmuF]
  • Structure

  • [PDB|1QWR]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7934877], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE35790 ([gene|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|pmi]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCGTACCCCTCCCC, downstream forward: _UP4_TAAACTTAATCTCACTTCGA
  • BKK35790 ([gene|AC79E2A80664B4D165A0AE46CEA124C57EB9770D|pmi]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCGTACCCCTCCCC, downstream forward: _UP4_TAAACTTAATCTCACTTCGA
  • References

  • 7934877,23204422