SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


GMP synthetase (glutamine-hydrolysing)
57.78 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
biosynthesis of GMP
GMP synthetase (glutamine-hydrolysing)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    692,740 694,281

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + L-glutamine + XMP --> AMP + diphosphate + GMP + 2 H+ + L-glutamate (according to UniProt)
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-1 domain] (aa 8-198) (according to UniProt)
  • GMPS ATP-PPase domain (aa 199-388) (according to UniProt)
  • Effectors of protein activity

  • the enzyme is inhibited by guanosine tetraphosphate ([SW|stringent response]) [Pubmed|409404]
  • Structure

  • [PDB|2YWB] (from ''Thermus thermophilus hb8'', 45% identity, 57% similarity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1312531], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-A918 (yebB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06360 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGTCACCTAATCTC, downstream forward: _UP4_TAAGAATCAATTAATGGAAA
  • BKK06360 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTGTCACCTAATCTC, downstream forward: _UP4_TAAGAATCAATTAATGGAAA
  • References


  • 11395405
  • Original publications

  • 1722815,1312531,409404,15378759,24682323,27120414,30974118