SubtiBank SubtiBank
rsbV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rsbV

antagonist of [protein|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|RsbW], anti-anti-[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]
locus
BSU04710
pI
4.70
mw
11.80 kDa
protein length
109 aa Sequence Blast
gene length
330 bp Sequence Blast
function
control of [protein|search|SigB ]activity
product
anti-anti-[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    522,088 522,417

    The protein

    Protein family

  • STAS domain (according to Swiss-Prot)
  • Modification

  • phosphorylation on Ser-52 AND Ser-56 by [protein|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|RsbW] [Pubmed|17218307], [Pubmed|17726680]
  • Structure

  • [PDB|1VC1] (homolog from Thermotoga maritima)
  • Expression and Regulation

    Operons

    genes
    [gene|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR]-[gene|841CE7FCA4E84445830CA18F9856F6F30014E3BB|rsbS]-[gene|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT]-[gene|0B8381D2C724DAA724E4AFC67000F12AD112D13D|rsbU]-[gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|8002610]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002610], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|20454630], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]-[gene|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW]-[gene|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]-[gene|8536803BDFB58D43C52961931F609933E49E989D|rsbX]
    description
    [Pubmed|2170324]

    regulation

  • ''[protein|search|rsbV]:'' induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE04710 ([gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTATCACCTCAAATT, downstream forward: _UP4_GCAAAGTCAGAAGGTGGAGT
  • BKK04710 ([gene|AC64DA463250A090A62E50901EFE653C8F963872|rsbV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTATCACCTCAAATT, downstream forward: _UP4_GCAAAGTCAGAAGGTGGAGT
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

  • 12867438,8144446,8002610,8682769,11591687,9658013,8682789,8955331,8764398,8824586,10632888,8808936,7601843,15342585,12270815,12950915,8955331,17726680,11544224,17218307,20454630,27977677