SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


3-isopropylmalate dehydratase (large subunit)
52.23 kDa
protein length
472 aa Sequence Blast
gene length
1419 bp Sequence Blast
biosynthesis of leucine
3-isopropylmalate dehydratase (large subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,889,552 2,890,970

    The protein

    Catalyzed reaction/ biological activity

  • (2R,3S)-3-isopropylmalate --> (2S)-2-isopropylmalate (according to UniProt)
  • Protein family

  • aconitase/IPM isomerase family (with [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB], according to UniProt)
  • Modification

  • phosphorylated on Arg-81 [Pubmed|22517742]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|4KP2] (from Methanococcus jannaschii, 35% identity)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1577690], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: termination/antitermination, via tRNA controlled [SW|RNA switch], repression by BCAA, in [regulon|T-box|T-box]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|15547269], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|12193635], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [PubMed|12193635]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|18697947]
  • Biological materials


  • BKE28260 ([gene|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTATTTCCTCCCTC, downstream forward: _UP4_ACAGTTGTGTAAGGAGTGCG
  • BKK28260 ([gene|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTATTTCCTCCCTC, downstream forward: _UP4_ACAGTTGTGTAAGGAGTGCG
  • References

  • 15060025,12193635,19258532,18697947,8289305,18641142,20935095,15547269,12618455,12107147,22517742,24163341,15378759,25755103,25157083,26220295