SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sequence-independent DNA-binding and DNA-bending protein (Lrp family), facilitates the formation of higher order protein-DNA complexes
16.31 kDa
protein length
144 aa Sequence Blast
gene length
435 bp Sequence Blast
DNA repair/ recombination
DNA-binding and -bending protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    476,059 476,493

    The protein

    Protein family

  • ([SW|Lrp family])
  • [SW|Domains]

  • [SW|HTH asnC-type domain] (aa 3-64) (according to UniProt)
  • Structure

  • [PDB|2CFX] [pubmed|16528101]
  • Expression and Regulation




  • [pubmed|22383849]
  • sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|10913073], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    additional information

  • 50 ... 300 molecules per cell [PubMed|10913073]
  • Biological materials


  • MGNA-C106 (ydaI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04250 ([gene|AC2618C53DA020F2CD5192AEE462D15E8EE0F57F|lrpC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACATCCTTCTTTT, downstream forward: _UP4_TAGAGAGTGCCGCGCGAAGT
  • BKK04250 ([gene|AC2618C53DA020F2CD5192AEE462D15E8EE0F57F|lrpC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACATCCTTCTTTT, downstream forward: _UP4_TAGAGAGTGCCGCGCGAAGT
  • References

  • 9341680,10913073,16407330,10606655,12458218,16528101,16528101