SubtiBank SubtiBank
ywiC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywiC

unknown
locus
BSU_37300
pI
10.09
mw
27.40 kDa
protein length
239 aa Sequence Blast
gene length
720 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,830,761 3,831,480

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|ABB1A005B407C38CC1237949AEB9769FB001169C|ywiC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B664 (ywiC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1663 NBRP B. subtilis, Japan]
  • BKE37300 ([gene|ABB1A005B407C38CC1237949AEB9769FB001169C|ywiC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAAATCCTCCTTTTTT, downstream forward: _UP4_TAAAAAAACAAGGACACCGC
  • BKK37300 ([gene|ABB1A005B407C38CC1237949AEB9769FB001169C|ywiC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAAATCCTCCTTTTTT, downstream forward: _UP4_TAAAAAAACAAGGACACCGC