SubtiBank SubtiBank
purA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purA

adenylosuccinate synthetase
locus
BSU40420
pI
5.46
mw
47.51 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast
function
purine biosynthesis
product
adenylosuccinate synthetase
essential
no
ec
6.3.4.4
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    4,155,433 4,156,725

    The protein

    Catalyzed reaction/ biological activity

  • GTP + IMP + L-aspartate = GDP + phosphate + N(6)-(1,2-dicarboxyethyl)-AMP (according to Swiss-Prot)
  • Protein family

  • adenylosuccinate synthetase family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-97 [Pubmed|22517742]
  • Structure

  • [PDB|1KJX] (from ''Escherichia coli k12'', 46% identity, 64% similarity) [Pubmed|11741996]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]
    description
    [Pubmed|1312531]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1312531], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, [Pubmed|7638212], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.9 fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    genes
    [gene|CA7C472698CB9B9D75573377F42CCEE055D73EDD|yycE]-[gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE40420 ([gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCGTGCACCTCCGTT, downstream forward: _UP4_TAAATAGAATATGTCTGCAA
  • BKK40420 ([gene|AB4B8B7325A1BF444D841EF1BBBCEC2D506AE600|purA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCGTGCACCTCCGTT, downstream forward: _UP4_TAAATAGAATATGTCTGCAA
  • References

  • 1722815,1312531,7638212,12850135,21424839,22517742,15378759,27234879,30974118