SubtiBank SubtiBank
guaB
The papers of the month are back! Check them out! Link here

guaB

IMP dehydrogenase
locus
BSU00090
pI
6.17
mw
52.82 kDa
protein length
488 aa Sequence Blast
gene length
1464 bp Sequence Blast
function
biosynthesis of GMP
product
IMP dehydrogenase
essential
no
ec
1.1.1.205
synonyms
guaA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    15,915 → 17,381

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • reduced expression of ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]'' suppresses the requirement of a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant for branched chain amino acids, methionine and threonine [Pubmed|24163341]
  • The protein

    Catalyzed reaction/ biological activity

  • Inosine 5'-phosphate NAD H2O = xanthosine 5'-phosphate NADH (according to Swiss-Prot)
  • Protein family

  • IMPDH/GMPR family (according to Swiss-Prot)
  • [SW|Domains]

  • 2 [SW|CBS domain]s (95-153, 157-214)
  • Modification

  • phosphorylated (STY) [Pubmed|17726680]
  • Cys308 is S-cysteinylated after diamide stress [Pubmed|17611193], [Pubmed|17726680]
  • Cys308 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|22938038]
  • Effectors of protein activity

  • inhibition of enzymatic activity by (p)ppGpp during the 'stringent response'[Pubmed|22981860,6111556]
  • Structure

  • [PDB|3TSB] (from ''B. anthracis'', 80% identity) [pubmed|22788966]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • activated during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BKE00090 (Δ[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTAAATCCCCCTCTT, downstream forward: _UP4_TAATAAATTGTTACAAATTA
  • BKK00090 (Δ[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTAAATCCCCCTCTT, downstream forward: _UP4_TAATAAATTGTTACAAATTA
  • Expression vector

  • purification from ''B. subtilis'' with an N-terminal Strep-tag, for [SW|SPINE], (in [SW|pGP380]): pGP901, available in [SW|Jörg Stülke]'s lab
  • pGP2937 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 22938038,17611193,12884008,1722815,22981860,12618455,17726680,17726680,6111556,24163341,15378759,24682323,25572472,26883633,28189581