SubtiBank SubtiBank
guaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

guaB

IMP dehydrogenase
locus
BSU_00090
pI
6.17
mw
52.82 kDa
protein length
488 aa Sequence Blast
gene length
1467 bp Sequence Blast
function
biosynthesis of GMP
product
IMP dehydrogenase
essential
no
ec
1.1.1.205
synonyms
guaA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    15,915 17,381

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • reduced expression of ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]'' suppresses the requirement of a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant for branched chain amino acids, methionine and threonine [Pubmed|24163341]
  • The protein

    Catalyzed reaction/ biological activity

  • Inosine 5'-phosphate + NAD+ + H2O --> xanthosine 5'-phosphate + NADH (according to UniProt)
  • Protein family

  • IMPDH/GMPR family (together with [protein|350A0C0D0ADB2A8E8DA9900E75A0D9914F18C665|GuaC]) (according to UniProt)
  • [SW|Domains]

  • 2 [SW|CBS domain]s (95-153, 157-214)
  • Modification

  • phosphorylated (STY) [Pubmed|17726680]
  • Cys308 is S-cysteinylated after diamide stress [Pubmed|17611193], [Pubmed|17726680]
  • Cys308 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|22938038]
  • Effectors of protein activity

  • inhibition of enzymatic activity by (p)ppGpp during the 'stringent response'[Pubmed|22981860,6111556]
  • Structure

  • [PDB|3TSB] (from ''B. anthracis'', 80% identity) [pubmed|22788966]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|AB3D18228DB6819B0C81BC7A8BB3408A4F75DC0C|guaB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • activated during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BKE00090 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTAAATCCCCCTCTT, downstream forward: _UP4_TAATAAATTGTTACAAATTA
  • BKK00090 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTAAATCCCCCTCTT, downstream forward: _UP4_TAATAAATTGTTACAAATTA
  • Expression vectors

  • purification from ''B. subtilis'' with an N-terminal Strep-tag, for [SW|SPINE], (in [SW|pGP380]): pGP901, available in [SW|Jörg Stülke]'s lab
  • pGP2937 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 22938038,17611193,12884008,1722815,22981860,12618455,17726680,17726680,6111556,24163341,15378759,24682323,25572472,26883633,28189581