SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


IMP dehydrogenase
52.82 kDa
protein length
488 aa Sequence Blast
gene length
1467 bp Sequence Blast
biosynthesis of GMP
IMP dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    15,915 17,381

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • reduced expression of ''[gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]'' suppresses the requirement of a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant for branched chain amino acids, methionine and threonine [Pubmed|24163341]
  • The protein

    Catalyzed reaction/ biological activity

  • Inosine 5'-phosphate + NAD+ + H2O --> xanthosine 5'-phosphate + NADH (according to UniProt)
  • Protein family

  • IMPDH/GMPR family (together with [protein|350A0C0D0ADB2A8E8DA9900E75A0D9914F18C665|GuaC]) (according to UniProt)
  • [SW|Domains]

  • 2 [SW|CBS domain]s (aa 95-153, aa 157-214) (according to UniProt)
  • Modification

  • phosphorylated (STY) [Pubmed|17726680]
  • Cys308 is S-cysteinylated after diamide stress [Pubmed|17611193], [Pubmed|17726680]
  • Cys308 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|22938038]
  • Effectors of protein activity

  • inhibition of enzymatic activity by (p)ppGpp during the 'stringent response'[Pubmed|22981860,6111556]
  • Structure

  • [PDB|3TSB] (from ''B. anthracis'', 80% identity) [pubmed|22788966]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • activated during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • BKE00090 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTAAATCCCCCTCTT, downstream forward: _UP4_TAATAAATTGTTACAAATTA
  • BKK00090 ([gene|AC67305E4C165CC1D785E49B7CD8335346134376|guaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTAAATCCCCCTCTT, downstream forward: _UP4_TAATAAATTGTTACAAATTA
  • Expression vectors

  • purification from ''B. subtilis'' with an N-terminal Strep-tag, for [SW|SPINE], (in [SW|pGP380]): pGP901, available in [SW|Jörg Stülke]'s lab
  • pGP2937 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 22938038,17611193,12884008,1722815,22981860,12618455,17726680,17726680,6111556,24163341,15378759,24682323,25572472,26883633,28189581