SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


inhibitor of [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] metalloprotease
29.46 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] activation
inhibitor of [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] metalloprotease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,856,832 2,857,626

    The protein


  • the ectodomain of [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA] is cleaved off by [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|SpoIVB] (first cleavage) [Pubmed|24243021]
  • the domains that inhibits [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] is cleaved off by [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] (second cleavage) [Pubmed|24243021]
  • [SW|Localization]

  • integral mother cell membrane protein [Pubmed|24243021,11959848]
  • Additional information

  • the ectodomain of [protein|AB2A3422277040107AAF90358BBE58608F8E0738|SpoIVFA] is cleaved off by [protein|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|SpoIVB] (first cleavage) [Pubmed|24243021]
  • the domains that inhibits [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB] is cleaved off by [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB] (second cleavage) {{PubMed|24243021}
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,1942049], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab



  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab

    Biological materials


  • BKE27980 ([gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCATCATCCTTTGCA, downstream forward: _UP4_ATTGATCCGATTCAGGTGAT
  • BKK27980 ([gene|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCATCATCCTTTGCA, downstream forward: _UP4_ATTGATCCGATTCAGGTGAT
  • References


  • 31350897
  • Original Publications

  • 11959848,9501233,1577688,15292188,2115401,12940997,9078383,15752199,16818230,15699190,1942049,15383836,17557826,24243021,22383849,30403663