SubtiBank SubtiBank
yqaC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqaC

unknown
locus
BSU_26370
pI
7.21
mw
20.56 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,700,033 2,700,569

    Biological materials

    Mutant

  • BKE26370 ([gene|AB1F50E0CAE250F264D294F2D5A9936B5710F518|yqaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTCCCCTCCTTATTA, downstream forward: _UP4_TAAACTAACGGATAGCAATA
  • BKK26370 ([gene|AB1F50E0CAE250F264D294F2D5A9936B5710F518|yqaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTCCCCTCCTTATTA, downstream forward: _UP4_TAAACTAACGGATAGCAATA