SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


formation of 2-deoxy-5-keto-gluconic acid-6-phosphate (5th reaction)
35.48 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
myo-inositol catabolism
formation of 2-deoxy-5-keto-gluconic acid-6-phosphate (5th reaction)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • Gene

    4,081,029 4,082,006

    The protein

    Catalyzed reaction/ biological activity

  • 5-dehydro-2-deoxy-D-gluconate + ATP --> 6-phospho-5-dehydro-2-deoxy-D-gluconate + ADP + H+ (according to UniProt)
  • Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|2QCV] (from ''Bacillus halodurans c-125 mutant'', 73% identity, 85% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials


  • MGNA-B772 (iolC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39740 ([gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTAAACAGCCACTCCT, downstream forward: _UP4_TAATTGAAAAAGATCGAGTA
  • BKK39740 ([gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTAAACAGCCACTCCT, downstream forward: _UP4_TAATTGAAAAAGATCGAGTA
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,18310071,9887260,18310071