SubtiBank SubtiBank
swrC [2019-06-21 11:40:30]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

swrC [2019-06-21 11:40:30]

similar to acriflavin resistance protein
locus
BSU06710
pI
4.76
mw
114.79 kDa
protein length
1065 aa Sequence Blast
gene length
3198 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yerP

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    732,916 736,113

    The protein

    Structure

  • [PDB|5T0O] (from Campylobacter jejuni, 23% identity) [pubmed|28761097]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|AAC32230E3E585932A876737131C3E2C15168B2A|swrC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A930 (yerP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/930 NBRP B. subtilis, Japan]
  • BKE06710 ([gene|AAC32230E3E585932A876737131C3E2C15168B2A|swrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATATAATACTAAAC, downstream forward: _UP4_TAAAAAACAAAAAGCCTCAG
  • BKK06710 ([gene|AAC32230E3E585932A876737131C3E2C15168B2A|swrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATATAATACTAAAC, downstream forward: _UP4_TAAAAAACAAAAAGCCTCAG
  • References

  • 18763711,11709341,15066026,21630458,28761097