SubtiBank SubtiBank
swrC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

swrC

similar to acriflavin resistance protein
locus
BSU_06710
pI
4.76
mw
114.79 kDa
protein length
1065 aa Sequence Blast
gene length
3198 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yerP

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    732,916 736,113

    The protein

    Protein family

  • resistance-nodulation-cell division (RND) (TC 2.A.6) family (with [protein|1632474628BEA113F297897D152276A1AB73BAE8|YdgH] and [protein|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|YdfJ], according to UniProt)
  • Structure

  • [PDB|5T0O] (from Campylobacter jejuni, 23% identity) [pubmed|28761097]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|AAC32230E3E585932A876737131C3E2C15168B2A|swrC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A930 (yerP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/930 NBRP B. subtilis, Japan]
  • BKE06710 ([gene|AAC32230E3E585932A876737131C3E2C15168B2A|swrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATATAATACTAAAC, downstream forward: _UP4_TAAAAAACAAAAAGCCTCAG
  • BKK06710 ([gene|AAC32230E3E585932A876737131C3E2C15168B2A|swrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATATAATACTAAAC, downstream forward: _UP4_TAAAAAACAAAAAGCCTCAG
  • References

  • 18763711,11709341,15066026,21630458,28761097