SubtiBank SubtiBank
sacB [2019-07-12 08:31:06]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sacB [2019-07-12 08:31:06]

52.80 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
utilization of sucrose, production of levan

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of sucrose]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,536,012 3,537,433

    The protein

    Catalyzed reaction/ biological activity

  • Sucrose (6)-beta-D-fructofuranosyl-(2)(n) alpha-D-glucopyranoside = glucose (6)-beta-D-fructofuranosyl-(2)(n 1) alpha-D-glucopyranoside (according to Swiss-Prot)
  • Protein family

  • glycosyl hydrolase 68 family (according to Swiss-Prot)
  • Structure

  • [PDB|1PT2] (complex with sucrose), [PDB|1OYG]
  • [SW|Localization]

  • secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2428811], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|2428811], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]: antitermination, /antitermination via binding to a [SW|RNA switch], in [regulon|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY regulon]
  • regulation

  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT, downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
  • BKK34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT, downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
  • lacZ fusion

  • pGP564 (in [SW|pAC7]), a series of RAT mutations in [SW|pAC7], all available in [SW|Jörg Stülke]'s lab
  • References


  • 20735481
  • Original publications

  • 6402497,2428811,18197985,18957862,2105292,11739774,3039303,22247149,26256357,26600431,26646447,28871528,29131629,28433290,29794222,30301900,30703417