SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


52.80 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
utilization of sucrose, production of levan

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of sucrose]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,536,012 3,537,433

    The protein

    Catalyzed reaction/ biological activity

  • [6)-β-D-fructofuranosyl-(2→](n) α-D-glucopyranoside + sucrose --> [6)-β-D-fructofuranosyl-(2→](n+1) α-D-glucopyranoside + D-glucose (according to UniProt)
  • Protein family

  • glycosyl hydrolase 68 family (single member, according to UniProt)
  • Structure

  • [PDB|1PT2] (complex with sucrose), [PDB|1OYG]
  • [SW|Localization]

  • secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2428811], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|2428811], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]: antitermination, /antitermination via binding to a [SW|RNA switch], in [regulon|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY regulon]
  • regulation

  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT, downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
  • BKK34450 ([gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCATGTCTCCTTTT, downstream forward: _UP4_TAAAAACGCAAAAGAAAATG
  • lacZ fusion

  • pGP564 (in [SW|pAC7]), a series of RAT mutations in [SW|pAC7], all available in [SW|Jörg Stülke]'s lab
  • References


  • 20735481
  • Original publications

  • 6402497,2428811,18197985,18957862,2105292,11739774,3039303,22247149,26256357,26600431,26646447,28871528,29131629,28433290,29794222,30301900,30703417,32553967