SubtiBank SubtiBank
alsS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

alsS

acetolactate synthase
locus
BSU36010
pI
5.16
mw
61.95 kDa
protein length
571 aa Sequence Blast
gene length
1713 bp Sequence Blast
function
overflow metabolism
product
acetolactate synthase
essential
no
ec
2.2.1.6
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • Gene

    Coordinates
    3,709,628 → 3,711,340

    The protein

    Catalyzed reaction/ biological activity

  • 2 pyruvate = 2-acetolactate CO2 (according to Swiss-Prot)
  • Protein family

  • TPP enzyme family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|IlvB], [protein|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|YdaP]
  • [SW|Cofactors]

  • Mg2 [Pubmed|25393087]
  • TPP [Pubmed|25393087]
  • FAD (according to UniProt)
  • Structure

  • [PDB|4RJJ] (complex wit TPP) [Pubmed|25393087]
  • Expression and Regulation

    Operons

    genes
    [gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD]
    description
    [Pubmed|7685336]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7685336], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR]: activation, in the presence of acetate [Pubmed|7685336], in [regulon|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, if the ratio NADH2/NAD is high [Pubmed|16428414], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [regulon|stringent response|stringent response]: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • induction by acetate ([protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR]) [Pubmed|30039521,7685336]
  • expression is heterogeneous [pubmed|29809139]
  • view in new tab

    Biological materials

    Mutant

  • 1A979 ( ''alsS''::''cat''), [Pubmed|7685336], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A979&Search=1A979 BGSC]
  • BKE36010 (Δ[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACACCCTCACTCCTTATT, downstream forward: _UP4_TAGCACTCTGCGCATCACGA
  • BKK36010 (Δ[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACACCCTCACTCCTTATT, downstream forward: _UP4_TAGCACTCTGCGCATCACGA
  • References

  • 19087206,10986270,20081037,16428414,19383131,7685336,16428414,19684168,24734205,22178965,25393087,29809139,30039521