SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


acetolactate synthase
61.95 kDa
protein length
571 aa Sequence Blast
gene length
1713 bp Sequence Blast
overflow metabolism
acetolactate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Overflow metabolism]
  • Gene

    3,709,628 → 3,711,340

    The protein

    Catalyzed reaction/ biological activity

  • H+ + 2 pyruvate --> (2S)-2-acetolactate + CO2 (according to UniProt)
  • Protein family

  • [SW|TPP enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|IlvB], [protein|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|YdaP]
  • [SW|Cofactors]

  • Mg2 [Pubmed|25393087]
  • TPP [Pubmed|25393087]
  • FAD (according to UniProt)
  • Structure

  • [PDB|4RJJ] (complex wit TPP) [Pubmed|25393087]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7685336], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR]: activation, in the presence of acetate [Pubmed|7685336], in [regulon|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, if the ratio NADH2/NAD is high [Pubmed|16428414], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [regulon|stringent response|stringent response]: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • induction by acetate ([protein|8BA7714236EBFDBB9987F1DACC9775AD974C743E|AlsR]) [Pubmed|30039521,7685336]
  • expression is heterogeneous [pubmed|29809139]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • 1A979 ( ''alsS''::''cat''), [Pubmed|7685336], available at [ BGSC]
  • BKE36010 (Δ[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACACCCTCACTCCTTATT, downstream forward: _UP4_TAGCACTCTGCGCATCACGA
  • BKK36010 (Δ[gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACACCCTCACTCCTTATT, downstream forward: _UP4_TAGCACTCTGCGCATCACGA
  • References

  • 19087206,10986270,20081037,16428414,19383131,7685336,16428414,19684168,24734205,22178965,25393087,29809139,30039521,31113899