SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


formation of 5-deoxy-D-glucuronic acid (3rd reaction)
63.96 kDa
protein length
637 aa Sequence Blast
gene length
1914 bp Sequence Blast
myo-inositol catabolism
formation of 5-deoxy-D-glucuronic acid (3rd reaction)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • Gene

    4,079,083 4,080,996

    The protein

    Catalyzed reaction/ biological activity

  • 3D-3,5/4-trihydroxycyclohexane-1,2-dione + H2O --> 5-deoxy-D-glucuronate + H+ (according to UniProt)
  • Protein family

  • [SW|TPP enzyme family] (according to UniProt)
  • Structure

  • [PDB|1V5E] (pyruvate oxidase from Aerococcus viridans, 25% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials


  • MGNA-B773 (iolD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39730 ([gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAACGATCCCACCTTTA, downstream forward: _UP4_CAGTATTAGAGGGGAGGCAC
  • BKK39730 ([gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAACGATCCCACCTTTA, downstream forward: _UP4_CAGTATTAGAGGGGAGGCAC
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,18310071,9887260,18310071