SubtiBank SubtiBank
yfkS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfkS

D protein for the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|YfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|YfkT] germinant receptor of unknown specificity, general stress protein, survival of ethanol and paraquat stresses
locus
BSU07770
pI
10.01
mw
7.67 kDa
protein length
gene length
201 bp Sequence Blast
function
germination, survival of of stress conditions
product
D protein for the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|YfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|YfkT] germinant receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.5|Germination/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    847,282 847,482

    The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[gene|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[gene|AA76BEF6A4CECB5D3910918E8D91D8B919EDEA7E|yfkS]-[gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C344 (yfkS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2342 NBRP B. subtilis, Japan]
  • BKE07770 ([gene|AA76BEF6A4CECB5D3910918E8D91D8B919EDEA7E|yfkS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGACGCACCTCCATT, downstream forward: _UP4_TGAACATGACAGAAAGGATG
  • BKK07770 ([gene|AA76BEF6A4CECB5D3910918E8D91D8B919EDEA7E|yfkS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGACGCACCTCCATT, downstream forward: _UP4_TGAACATGACAGAAAGGATG
  • References

  • 15699190,22383849,10762253,15805528,23625846,22582280