SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


catechol 2,3-dioxygenase, detoxification of environmental catechols, protects cells from intoxication by endogenous bacillibactin-derived catechol metabolites under iron-limited conditions
31.37 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
detoxification of catechol
catechol 2,3-dioxygenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    898,010 898,867

    Phenotypes of a mutant

  • not viable in the presence of catechol [pubmed|30377275]
  • The protein

    Catalyzed reaction/ biological activity

  • catechol + O2 --> (2Z,4E)-2-hydroxy-6-oxohexa-2,4-dienoate + H+ (according to UniProt)
  • Protein family

  • [SW|extradiol ring-cleavage dioxygenase family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|VOC domain]s (aa 9-126, aa 169-285) (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20639328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, [Pubmed|20639328], in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • [protein|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR]: repression, [Pubmed|20639328], in [regulon|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|30377275], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • strong induction by diamide and quinones (such as catechol) ([protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB], [protein|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR]) [Pubmed|16872404,20639328]
  • induced by iron starvation ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|30377275]
  • view in new tab

    Biological materials


  • MGNA-C295 (yfiE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08240 ([gene|AA75013C05E1A88FC51410F9F1B30EE7D15F34C2|catE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCATGCTGCATGCCTCTT, downstream forward: _UP4_TAACTGCAATCCCCTTGCCG
  • BKK08240 ([gene|AA75013C05E1A88FC51410F9F1B30EE7D15F34C2|catE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCATGCTGCATGCCTCTT, downstream forward: _UP4_TAACTGCAATCCCCTTGCCG
  • References

  • 17407181,16872404,20639328,30377275