SubtiBank SubtiBank
gerM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerM

lipoprotein, germination (cortex hydrolysis) and sporulation, required for the assembly of the basal platform of the SpoIIIA-SpoIIQ transenvelope complex during sporulation
locus
BSU28380
pI
4.68
mw
39.41 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
function
germination (cortex hydrolysis) and sporulation
product
SpoIIQ recruitment factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    2,902,002 2,903,102

    Phenotypes of a mutant

  • inactivation of ''[gene|AA519F0D7DC94165C2CF5F7E230502D884898B71|gerM]'' reduces sporulation efficiency to 0.3% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • required for the assembly of the basal platform of the [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] transenvelope complex during [SW|sporulation] [Pubmed|27381174]
  • required for the recruitment of [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] to the septal membranes on the forespore side [Pubmed|27381174]
  • Structure

  • [PDB|6GZ8] (first GerMN domain) [Pubmed|30266596]
  • [PDB|6GZB] (tandem GerMN domains) [Pubmed|30266596]
  • [SW|Localization]

  • lipoprotein, outer forespore membrane, localization depends on [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] and [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] [Pubmed|27381174]
  • Expression and Regulation

    Operons

    genes
    [gene|AA519F0D7DC94165C2CF5F7E230502D884898B71|gerM]
    description
    [Pubmed|8969504]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8969504,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|8969504,15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE28380 ([gene|AA519F0D7DC94165C2CF5F7E230502D884898B71|gerM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTTCCCTCCTAAGG, downstream forward: _UP4_TAAATTGGGATTTTTGATAT
  • BKK28380 ([gene|AA519F0D7DC94165C2CF5F7E230502D884898B71|gerM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTTCCCTCCTAAGG, downstream forward: _UP4_TAAATTGGGATTTTTGATAT
  • References

  • 7926687,15699190,12107147,8969504,15699190,15383836,18562273,26735940,27381174,30266596