SubtiBank SubtiBank
gerM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerM

lipoprotein, germination (cortex hydrolysis) and sporulation, required for the assembly of the basal platform of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] trans-envelope complex during sporulation
locus
BSU_28380
pI
4.68
mw
39.41 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
function
germination (cortex hydrolysis) and sporulation
product
[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] recruitment factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    2,902,002 2,903,102

    Phenotypes of a mutant

  • inactivation of ''[gene|AA519F0D7DC94165C2CF5F7E230502D884898B71|gerM]'' reduces sporulation efficiency to 0.3% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • required for the assembly of the basal platform of the [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] transenvelope complex during [SW|sporulation] [Pubmed|27381174]
  • required for the recruitment of [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] to the septal membranes on the forespore side [Pubmed|27381174]
  • Structure

  • [PDB|6GZ8] (first GerMN domain) [Pubmed|30266596]
  • [PDB|6GZB] (tandem GerMN domains) [Pubmed|30266596]
  • [SW|Localization]

  • lipoprotein, outer forespore membrane, localization depends on [protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] and [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] [Pubmed|27381174]
  • Expression and Regulation

    Operons

    genes
    [gene|AA519F0D7DC94165C2CF5F7E230502D884898B71|gerM]
    description
    [Pubmed|8969504]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8969504,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|8969504,15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE28380 ([gene|AA519F0D7DC94165C2CF5F7E230502D884898B71|gerM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTTCCCTCCTAAGG, downstream forward: _UP4_TAAATTGGGATTTTTGATAT
  • BKK28380 ([gene|AA519F0D7DC94165C2CF5F7E230502D884898B71|gerM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTTCCCTCCTAAGG, downstream forward: _UP4_TAAATTGGGATTTTTGATAT
  • References

    Reviews

  • 31350897
  • Original Publications

  • 7926687,15699190,12107147,8969504,15699190,15383836,18562273,26735940,27381174,30266596