SubtiBank SubtiBank
ytzJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytzJ

unknown
locus
BSU_29249
pI
4.85
mw
7.30 kDa
protein length
gene length
192 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,995,699 2,995,890

    Expression and Regulation

    Operons

    genes
    [gene|AA2360658303BBC4B3D2DA4AB02CC39A335754EA|ytzJ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE29249 ([gene|AA2360658303BBC4B3D2DA4AB02CC39A335754EA|ytzJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29249 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCTTCCTCCTTCCT, downstream forward: _UP4_CACTAAGAGAGAGGGTCTCC
  • BKK29249 ([gene|AA2360658303BBC4B3D2DA4AB02CC39A335754EA|ytzJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29249 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCTTCCTCCTTCCT, downstream forward: _UP4_CACTAAGAGAGAGGGTCTCC