SubtiBank SubtiBank
yfjT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfjT

unknown
locus
BSU07970
pI
3.99
mw
7.13 kDa
protein length
gene length
186 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    869,273 869,458

    Expression and Regulation

    Operons

    genes
    [gene|A9FA976AB3C8EE8B060BC674D13025ACF6E7DC0F|yfjT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C349 (yfjT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2347 NBRP B. subtilis, Japan]
  • BKE07970 ([gene|A9FA976AB3C8EE8B060BC674D13025ACF6E7DC0F|yfjT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTCCTCCATTCAT, downstream forward: _UP4_TAAAACCGCGTGCCCGCCGC
  • BKK07970 ([gene|A9FA976AB3C8EE8B060BC674D13025ACF6E7DC0F|yfjT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTCCTCCATTCAT, downstream forward: _UP4_TAAAACCGCGTGCCCGCCGC