SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aliphatic sulfonate monooxygenase
41.64 kDa
protein length
376 aa Sequence Blast
gene length
1131 bp Sequence Blast
sulfonate reduction
aliphatic sulfonate monooxygenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • Gene

    964,027 965,157

    The protein

    Catalyzed reaction/ biological activity

  • alkanesulfonate + FMNH2 + O2 --> aldehyde + FMN + 2 H+ + H2O + sulfite (according to UniProt)
  • Protein family

  • ssuD family (single member, according to UniProt)
  • Structure

  • [PDB|1NQK] (from ''Escherichia coli'', 64% identity, 76% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11251850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials


  • MGNA-B466 (ygcA::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A951 ( ''ssuD''::''cat''), [Pubmed| ], available at [ BGSC]
  • 1A8083 ( ''ssuD''::''kan''), [Pubmed|11445163], available at [ BGSC]
  • BKE08860 ([gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATCTCCCCTTTAT, downstream forward: _UP4_TGAGTTTAACTAAAATACAG
  • BKK08860 ([gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATCTCCCCTTTAT, downstream forward: _UP4_TGAGTTTAACTAAAATACAG
  • References

  • 15937167,11251850,16513748,9782504