SubtiBank SubtiBank
ssuD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ssuD

aliphatic sulfonate monooxygenase
locus
BSU08860
pI
5.37
mw
41.64 kDa
protein length
376 aa Sequence Blast
gene length
1131 bp Sequence Blast
function
sulfonate reduction
product
aliphatic sulfonate monooxygenase
essential
no
synonyms
ygcA, yzeC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • Gene

    Coordinates
    964,027 965,157

    The protein

    Catalyzed reaction/ biological activity

  • An alkanesufonate (R-CH(2)-SO3H) + FMNH2 + O2 = an aldehyde (R-CHO) + FMN + sulfite + H2O (according to Swiss-Prot)
  • Protein family

  • ssuD family (according to Swiss-Prot)
  • Structure

  • [PDB|1NQK] (from ''Escherichia coli'', 64% identity, 76% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|675CE0BCA393E9C2795032F1C0FDE6AF08B77033|ssuB]-[gene|B47C64731FCAA086CA563EEE95D3205428E51EFC|ssuA]-[gene|91EAC386AD3A373E7CDE0265AA23786ADC55558A|ssuC]-[gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]-[gene|93F7A5795A423CD8DD7B070F7F37731A5E8D6321|ygaN]
    description
    [Pubmed|11251850]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11251850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B466 (ygcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1465 NBRP B. subtilis, Japan]
  • 1A951 ( ''ssuD''::''cat''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A951&Search=1A951 BGSC]
  • 1A8083 ( ''ssuD''::''kan''), [Pubmed|11445163], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A8083&Search=1A8083 BGSC]
  • BKE08860 ([gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATCTCCCCTTTAT, downstream forward: _UP4_TGAGTTTAACTAAAATACAG
  • BKK08860 ([gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATCTCCCCTTTAT, downstream forward: _UP4_TGAGTTTAACTAAAATACAG
  • References

  • 15937167,11251850,16513748,9782504