SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


aliphatic sulfonate monooxygenase
41.64 kDa
protein length
376 aa Sequence Blast
gene length
1131 bp Sequence Blast
sulfonate reduction
aliphatic sulfonate monooxygenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • Gene

    964,027 965,157

    The protein

    Catalyzed reaction/ biological activity

  • alkanesulfonate + FMNH2 + O2 --> aldehyde + FMN + 2 H+ + H2O + sulfite (according to UniProt)
  • Protein family

  • ssuD family (single member, according to UniProt)
  • Structure

  • [PDB|1NQK] (from ''Escherichia coli'', 64% identity, 76% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11251850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials


  • MGNA-B466 (ygcA::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A951 ( ''ssuD''::''cat''), [Pubmed| ], available at [ BGSC]
  • 1A8083 ( ''ssuD''::''kan''), [Pubmed|11445163], available at [ BGSC]
  • BKE08860 ([gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATCTCCCCTTTAT, downstream forward: _UP4_TGAGTTTAACTAAAATACAG
  • BKK08860 ([gene|A9F7BEC330EB17CA38C4D421E8BBF58CE380559C|ssuD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATCTCCCCTTTAT, downstream forward: _UP4_TGAGTTTAACTAAAATACAG
  • References

  • 15937167,11251850,16513748,9782504