SubtiBank SubtiBank
atpC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

atpC

ATP synthase, part of the F1 complex (subunit epsilon)
locus
BSU_36800
pI
5.26
mw
14.07 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
ATP synthesis
product
ATP synthase (subunit epsilon)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.1|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,781,069 3,781,467

    The protein

    Catalyzed reaction/ biological activity

  • ATP synthesis [http://www.youtube.com/watch?v=uOoHKCMAUMc see a video]
  • Protein family

  • ATPase epsilon chain family (single member, according to UniProt)
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|2E5Y] (from ''Bacillus sp.'', 71% identity) [Pubmed|17581881]
  • [PDB|see here an overview on ATPase structure]
  • [SW|Localization]

  • cell membrane (Heterogeneous) [Pubmed|16479537]
  • peripheral via theF0 complex
  • Expression and Regulation

    Operons

    genes
    [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]-[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]-[gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]-[gene|87311FEA265AD3F5526C78D631E7E51BBF01F0D6|atpF]-[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]-[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]-[gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]-[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE36800 ([gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTTTACCCTCCTAGG, downstream forward: _UP4_TAAGAAAAAATCCTTCTCTT
  • BKK36800 ([gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTTTACCCTCCTAGG, downstream forward: _UP4_TAAGAAAAAATCCTTCTCTT
  • References

    Reviews

  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Original publications

  • 7961438,16479537,23967352,26028301,17581881,30580998,30809948