SubtiBank SubtiBank
yolD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yolD

unknown
locus
BSU_21510
pI
4.75
mw
12.86 kDa
protein length
110 aa Sequence Blast
gene length
334 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • The protein

    Paralogous protein(s)

  • [protein|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|YozL], [protein|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|YqjX]
  • Expression and Regulation

    Operons

    genes
    [gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]-[gene|BE8D5E038C0FD748C0F9C3F18DCA601BFFE8EA52|uvrX]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • BKE21510 ([gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGCCCCACTCCTTTA, downstream forward: _UP4_AATAACATCATAGGAGTTAC
  • BKK21510 ([gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGCCCCACTCCTTTA, downstream forward: _UP4_AATAACATCATAGGAGTTAC
  • References

  • 16267290,30916324