SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


12.86 kDa
protein length
110 aa Sequence Blast
gene length
334 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • The protein

    Paralogous protein(s)

  • [protein|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|YozL], [protein|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|YqjX]
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials


  • BKE21510 ([gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGCCCCACTCCTTTA, downstream forward: _UP4_AATAACATCATAGGAGTTAC
  • BKK21510 ([gene|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|yolD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGCCCCACTCCTTTA, downstream forward: _UP4_AATAACATCATAGGAGTTAC
  • References

  • 16267290,30916324