SubtiBank SubtiBank
cotT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotT

spore coat protein (inner)
locus
BSU12090
pI
9.47
mw
12.85 kDa
protein length
107 aa Sequence Blast
gene length
324 bp Sequence Blast
function
resistance of the spore
product
spore coat protein (inner)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.4|Class IV]
  • Gene

    Coordinates
    1,280,626 1,280,949

    The protein

    [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814,19933362]
  • Expression and Regulation

    Operons

    genes
    [gene|A997B442D165494199EE95D3DBB7C5C163E09D41|cotT]
    description
    [Pubmed|2546006]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|2546006,15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|2546006,15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • 1S108 ( ''cotT''::''cat''), [Pubmed|2546006], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S108&Search=1S108 BGSC]
  • BKE12090 ([gene|A997B442D165494199EE95D3DBB7C5C163E09D41|cotT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGAAAACCTCCCTAG, downstream forward: _UP4_TAGTCGCCACATATCAAAAT
  • BKK12090 ([gene|A997B442D165494199EE95D3DBB7C5C163E09D41|cotT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGAAAACCTCCCTAG, downstream forward: _UP4_TAGTCGCCACATATCAAAAT
  • labs

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
  • References

    Reviews

  • 23202530
  • Original publications

  • 10714992,1917883,2546006,15699190,15383836,19933362,22171814