SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore coat protein (inner)
12.85 kDa
protein length
107 aa Sequence Blast
gene length
324 bp Sequence Blast
resistance of the spore
spore coat protein (inner)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class IV]
  • Gene

    1,280,626 1,280,949

    The protein


  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814,19933362]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|2546006,15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|2546006,15699190,15383836]
  • view in new tab

    Biological materials


  • 1S108 ( ''cotT''::''cat''), [Pubmed|2546006], available at [ BGSC]
  • BKE12090 ([gene|A997B442D165494199EE95D3DBB7C5C163E09D41|cotT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGAAAACCTCCCTAG, downstream forward: _UP4_TAGTCGCCACATATCAAAAT
  • BKK12090 ([gene|A997B442D165494199EE95D3DBB7C5C163E09D41|cotT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGAAAACCTCCCTAG, downstream forward: _UP4_TAGTCGCCACATATCAAAAT
  • labs

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [ homepage]
  • References


  • 23202530
  • Original publications

  • 10714992,1917883,2546006,15699190,15383836,19933362,22171814