SubtiBank SubtiBank
rhiL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhiL

[SW|ABC transporter] (sugar-binding protein) for rhamnose oligosaccharides
locus
BSU06970
pI
4.99
mw
46.45 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
function
uptake of rhamnose oligosaccharides
product
rhamnose oligosaccharide [SW|ABC transporter]
essential
no
synonyms
yesO

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    761,662 762,945

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Structure

  • [PDB|4R6K]
  • [PDB|5Z6B] (complexed with rhamnogalacturonan trisaccharide)
  • [PDB|5Z6C] (complexed with rhamnogalacturonan)
  • [SW|Localization]

  • associated to the membrane (via [protein|2DC415DCC2ECC3B46526108638DDB46C28832041|RhiF]-[protein|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|RhiG]) [Pubmed|10092453]
  • Biological materials

    Mutant

  • MGNA-A947 (yesO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/947 NBRP B. subtilis, Japan]
  • BKE06970 ([gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCCCTTTAA, downstream forward: _UP4_AATGAGATATTAGAGAGGAA
  • BKK06970 ([gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCAATCCCCCCTTTAA, downstream forward: _UP4_AATGAGATATTAGAGAGGAA
  • References

  • 10092453,17449691,24391637