SubtiBank SubtiBank
cypA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cypA

cytochrome P450-like enzyme
locus
BSU_26740
pI
7.40
mw
47.22 kDa
protein length
410 aa Sequence Blast
gene length
1233 bp Sequence Blast
function
unknown
product
cytochrome P450-like enzyme
essential
no
synonyms
yrdE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,731,107 2,732,339

    The protein

    Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|YjiB], [protein|EF0F13BB682791E167EFC350BF029B08E8A1F410|PksS], [protein|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|BioI]
  • Structure

  • [PDB|4YZR] ([protein|EF0F13BB682791E167EFC350BF029B08E8A1F410|PksS], 44% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|A95C28DEE73AD25E28C45B88A7C03C92835F9705|cypA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE26740 ([gene|A95C28DEE73AD25E28C45B88A7C03C92835F9705|cypA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTCGACCTCCATCT, downstream forward: _UP4_TAATTTTTAGGGGATATGTG
  • BKK26740 ([gene|A95C28DEE73AD25E28C45B88A7C03C92835F9705|cypA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTCGACCTCCATCT, downstream forward: _UP4_TAATTTTTAGGGGATATGTG
  • References

    Research papers

  • 28898812