SubtiBank SubtiBank
yrdD/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrdD/2

part of the yrdD pseudogene
locus
BSU_26749
pI
0.00
mw
0.00 kDa
protein length
gene length
201 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    2,732,547 2,732,747

    Biological materials

    Mutant

  • BKE26749 ([gene|A9537602C11B92B766A719F0E3F4DC794A7731BA|yrdD/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26749 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTCTTGTCAGTACTTTAT, downstream forward: _UP4_TCCAAATCCTTAAAAGAGCC
  • BKK26749 ([gene|A9537602C11B92B766A719F0E3F4DC794A7731BA|yrdD/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26749 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTCTTGTCAGTACTTTAT, downstream forward: _UP4_TCCAAATCCTTAAAAGAGCC