SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component sensor kinase, control of [gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]-[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB] in response to lipid II-binding lantibiotics, such as nisin and gallidermin
40.02 kDa
protein length
356 aa Sequence Blast
gene length
1071 bp Sequence Blast
resistance against toxic peptides
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    3,566,358 3,567,428

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • two transmembrane segments
  • [SW|Histidine kinase domain] (aa 133-349) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Structure

  • [PDB|4I5S] (from Streptococcus mutans, the C-terminal histidine phosphotransferase domain, 29% identity) [pubmed|23468592]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21078927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR]: activation, [Pubmed|21078927], in [regulon|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR regulon]
  • regulation

  • ''[protein|search|psdA]'': induced by nisin, gallidermin ([protein|search|PsdR]) [Pubmed|21078927]
  • view in new tab

    Biological materials


  • MGNA-B636 (yvcQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34710 ([gene|A9525886E911164BDFF0A55DA9F5FDD1C1B7A3B6|psdS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGCGGTCGATGAGATAAG, downstream forward: _UP4_TAAGATTGGGGAGCGGAATT
  • BKK34710 ([gene|A9525886E911164BDFF0A55DA9F5FDD1C1B7A3B6|psdS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAGCGGTCGATGAGATAAG, downstream forward: _UP4_TAAGATTGGGGAGCGGAATT
  • References

  • 10094672,18394148,14651641,21283517,27188294,21078927,23468592