SubtiBank SubtiBank
upp
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

upp

uracil phosphoribosyltransferase
locus
BSU_36890
pI
5.86
mw
22.89 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
function
UMP synthesis
product
uracil phosphoribosyltransferase
essential
no
ec
2.4.2.9
synonyms
ipc-35d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    3,788,426 3,789,055

    The protein

    Catalyzed reaction/ biological activity

  • diphosphate + UMP --> 5-phospho-α-D-ribose 1-diphosphate + uracil (according to UniProt)
  • Protein family

  • UPRTase family (single member, according to UniProt)
  • Structure

  • [PDB|2EHJ] (from ''Escherichia coli'', 52% identity, 73% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|A92A17CAE2EF33C320B958325F9728EA0FD98F85|upp]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • 1A832 (no resistance), [Pubmed|12366828], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A832&Search=1A832 BGSC]
  • BKE36890 ([gene|A92A17CAE2EF33C320B958325F9728EA0FD98F85|upp]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTGTTTCAGCTCCT, downstream forward: _UP4_TAAAAAATGAAATCCCCAAA
  • BKK36890 ([gene|A92A17CAE2EF33C320B958325F9728EA0FD98F85|upp]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTGTTTCAGCTCCT, downstream forward: _UP4_TAAAAAATGAAATCCCCAAA
  • References

  • 7798145