SubtiBank SubtiBank
upp
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

upp

uracil phosphoribosyltransferase
locus
BSU_36890
pI
5.86
mw
22.89 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
function
UMP synthesis
product
uracil phosphoribosyltransferase
essential
no
ec
2.4.2.9
synonyms
ipc-35d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    3,788,426 3,789,055

    The protein

    Catalyzed reaction/ biological activity

  • diphosphate + UMP --> 5-phospho-α-D-ribose 1-diphosphate + uracil (according to UniProt)
  • Protein family

  • UPRTase family (single member, according to UniProt)
  • Structure

  • [PDB|2EHJ] (from ''Escherichia coli'', 52% identity, 73% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|A92A17CAE2EF33C320B958325F9728EA0FD98F85|upp]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • 1A832 (no resistance), [Pubmed|12366828], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A832&Search=1A832 BGSC]
  • BKE36890 ([gene|A92A17CAE2EF33C320B958325F9728EA0FD98F85|upp]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTGTTTCAGCTCCT, downstream forward: _UP4_TAAAAAATGAAATCCCCAAA
  • BKK36890 ([gene|A92A17CAE2EF33C320B958325F9728EA0FD98F85|upp]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTGTTTCAGCTCCT, downstream forward: _UP4_TAAAAAATGAAATCCCCAAA
  • References

  • 7798145