SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore coat protein
37.51 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
protection of the spore
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class II]
  • Gene

    1,494,403 1,495,368

    The protein


  • [PDB|1KNV] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8990290], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,15383836,8990290]
  • view in new tab

    Biological materials


  • MGNA-A056 (yknT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14250 ([gene|A922E599E67C4B93046E7F05F25CB32F9B14FAF0|yknT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGAACCATCTCCCTCA, downstream forward: _UP4_TAAAAAAACTGCTTGAGCGA
  • BKK14250 ([gene|A922E599E67C4B93046E7F05F25CB32F9B14FAF0|yknT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGAACCATCTCCCTCA, downstream forward: _UP4_TAAAAAAACTGCTTGAGCGA
  • References

  • 15699190,8990290,15383836,22171814,28870294