SubtiBank SubtiBank
yknT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yknT

spore coat protein
locus
BSU_14250
pI
7.16
mw
37.51 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms
cse15

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.2|Class II]
  • Gene

    Coordinates
    1,494,403 1,495,368

    The protein

    Structure

  • [PDB|1KNV] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|A922E599E67C4B93046E7F05F25CB32F9B14FAF0|yknT]
    description
    [Pubmed|8990290]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8990290], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,15383836,8990290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A056 (yknT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/56 NBRP B. subtilis, Japan]
  • BKE14250 ([gene|A922E599E67C4B93046E7F05F25CB32F9B14FAF0|yknT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGAACCATCTCCCTCA, downstream forward: _UP4_TAAAAAAACTGCTTGAGCGA
  • BKK14250 ([gene|A922E599E67C4B93046E7F05F25CB32F9B14FAF0|yknT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGAACCATCTCCCTCA, downstream forward: _UP4_TAAAAAAACTGCTTGAGCGA
  • References

  • 15699190,8990290,15383836,22171814,28870294