SubtiBank SubtiBank
tcyK [2018-05-04 19:27:35]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tcyK [2018-05-04 19:27:35]

cystine ABC transporter (binding protein)
locus
BSU29370
pI
9.01
mw
30.09 kDa
protein length
270 aa Sequence Blast
gene length
810 bp Sequence Blast
function
cystine uptake
product
cystine ABC transporter (binding protein)
essential
no
synonyms
ytmK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.9|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,006,600 → 3,007,412

    The protein

    Protein family

  • bacterial solute-binding protein 3 family (according to Swiss-Prot)
  • Structure

  • [PDB|2O1M]
  • [SW|Localization]

  • attached to the membrane via [protein|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|TcyL]-[protein|B1DD32A3B3D1C0C5391A40834940257357A2F30F|TcyM] [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
    description
    [Pubmed|15668000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A171 (ytmK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/171 NBRP B. subtilis, Japan]
  • 1A948 ( ''tcyK''::''kan''), [Pubmed|15262924], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A948&Search=1A948 BGSC]
  • BKE29370 (Δ[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGTTTTCATCTCATCGC, downstream forward: _UP4_TAGGTAAAAAGAGAGGGAGC
  • BKK29370 (Δ[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGTTTTCATCTCATCGC, downstream forward: _UP4_TAGGTAAAAAGAGAGGGAGC
  • References

  • 15262924,10092453,16109943,12193636,15668000,15272571,23944997